Hi Petra-
12E2 was a Mona Mehdy cDNA clone (Firtel Lab), this was RasD; I used a bit of the cDNA to make an antibody, this was the anti-Ras antibody used in the Christophe Reymond ras papers from the Firtel lab; here is a bit of the sequence:
catttagagaacaaattctaagagttaaagacaaagatagagtaccattg
3B1/ 2H3 was the cDNA I used to make our anti-prespore antibodies, we called this Beejin in the Gomer Datta Firtel J Cell Biol paper
here is a bit of sequence
gtgcaactggtcaaggcacatcaggtggtacacaggttcttg
16G1 was the prestalk cDNA I used to make our anti-prestalk antibody that we used to show the musical chairs mechanism, somewhat disproving the DIF gradient hypothesis of prestalk/ prespore initial cell fate, and which thus caused me so much trouble... in many papers I call this antigen pst-cathepsin
bit of sequence
tgataactggaactccaaaggtgattctcaaacagttttaggcttaaacaatt
cheers
Richard Gomer
Professor
TAMU Biology
ILSB MS 3474
301 Old Main Drive
College Station, TX 77843-3474
979 458 5745
________________________________________
From: DICTY [[log in to unmask]] on behalf of Petra Fey [[log in to unmask]]
Sent: Wednesday, December 07, 2011 3:13 PM
To: [log in to unmask]
Subject: [DICTY - 719] matching former clone names to genes
Dear Colleagues,
There are several papers from the 80ies and early 90ies (PMID 2556709, PMID: 3470762, PMID: 3109983 and many more) that talk about clones or mRNAs, but most often we do not have those names in dictyBase. We know of course pDd56/63, and we have the name 14E6 for pspB, D19 for pspA, and D11 for ampA. I also found 2H3 seems to be a terminator probe for cotC. But there are more names that I have a hard time to match and it would be nice to add those so our users can find them, and for us to link those papers to the correct genes.
- 2H6 (pst/psp - is it lvsB/ DDB_G0271504??)
- 10C3 (not cell type specific)
- D18 (psp)
- 7E3 (psp)
- 12H5 (psp)
- 15H3 (psp)
- D14 (pst
- PL1 (pst)
- 16G1 (pst
- 18G1 (pst)
There are probably more - feel free to add.
Thanks a lot for your help.
Holiday greetings,
Petra
------------------------------------------------------
Petra Fey
dictyBase Scientific Curator & Dicty Stock Center Manager
Northwestern University
Biomedical Informatics Center/NUCATS
750 N. Lake Shore Drive, 11-190
Chicago, IL 60611
USA
[log in to unmask]
http://dictybase.org/
------------------------------------------------------
|